Stem-loop sequence osa-MIR5798

AccessionMI0019811 (change log)
DescriptionOryza sativa miR5798 stem-loop
Stem-loop
   uu    -  c      --ug  a     cgg   -     a  gcau      agcuugagcguugugguggcaguacucucu 
5'   gaga gg aguccg    cu ugugg   uca uaggg gc    uuggca                              a
     |||| || ||||||    || |||||   ||| ||||| ||    ||||||                              a
3'   cucu cc uuaggc    ga acauc   ggu guccc cg    gaucgu                              g
   cc    a  -      ccua  -     --a   c     a  ----      ugaaagcauucuugugacguuaccuuuaau 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr7: 6672120-6672276 [-]
intergenic
Database links

Mature sequence osa-miR5798

Accession MIMAT0023266
Sequence

127 - 

cuggacuacaagaucccggau

 - 147

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).