Stem-loop sequence osa-MIR5790

AccessionMI0019802 (change log)
DescriptionOryza sativa miR5790 stem-loop
Stem-loop
          ucc   c  ag   cau  -cc      ---c  gu 
5' aagacga   uag ag  cuu   cu   acucca    ag  a
   |||||||   ||| ||  |||   ||   ||||||    ||   
3' uucugcu   auc uc  gag   ga   uggggu    uc  a
          uca   -  cu   ucc  aua      caac  aa 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 7740052-7740134 [-]
intergenic
Database links

Mature sequence osa-miR5790

Accession MIMAT0023257
Sequence

1 - 

aagacgauccuagcagagcuucau

 - 24

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).