Stem-loop sequence osa-MIR5789

AccessionMI0019801 (change log)
DescriptionOryza sativa miR5789 stem-loop
Stem-loop
       c     a       acga     -    a 
5' aauu auacc aauggag    ucagu acca a
   |||| ||||| |||||||    ||||| |||| g
3' uuag uaugg uugcuuc    aguca uggu g
       c     c       ---g     g    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr6: 1801934-1801998 [-]
intergenic
Database links

Mature sequence osa-miR5789

Accession MIMAT0023256
Sequence

40 - 

ugacugagcuucguucgguau

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).