Stem-loop sequence osa-MIR5488

AccessionMI0019006 (change log)
DescriptionOryza sativa miR5488 stem-loop
Literature search

2 open access papers mention osa-MIR5488
(2 sentences)

Stem-loop
   ac  a    a        a      a  -ucag  -ga    a     ccuugcgcguggugauuggauuuuuacugucauuuucucgcagaaggcacagauuggau 
5'   gc uuug ugaaggcg cugaug uu     ga   caca gauga                                                           c
     || |||| |||||||| |||||| ||     ||   |||| |||||                                                           a
3'   ug agac acuuuugu gauuac aa     cu   gugu cuauu                                                           u
   ca  a    -        a      c  uuaga  aag    -     uuuuaaacaaauaaauuuuccuaacacaaagaacguucgaacacuacgacaagucucau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 18039131-18039343 [+]
intergenic
Database links

Mature sequence osa-miR5488

Accession MIMAT0022121
Sequence

11 - 

ugaaggcgacugaugauuuca

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).