![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR1878 |
|||||
Accession | MI0017956 (change log) | ||||
Description | Brachypodium distachyon miR1878 stem-loop | ||||
Gene family | MIPF0001218; MIR1878 | ||||
Stem-loop |
uc c ----aa u a 5' acuauug aaacuuagucugaacacuauaaa augc caugu a ||||||| ||||||||||||||||||||||| |||| ||||| 3' ugaugac uuugaguuagacuugugauguuu uacg guaua a gu a agauac c a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bdi-miR1878-5p |
|
Accession | MIMAT0027040 |
Sequence |
13 - acuuagucugaacacuauaaaaaa - 36 |
Evidence | experimental; Illumina [3] |
Mature sequence bdi-miR1878-3p |
|
Accession | MIMAT0020565 |
Sequence |
65 - auuuguaguguucagauugaguuu - 88 |
Evidence | experimental; Illumina [3] |
References |
|
1 |
PMID:21352554
"Discovery of barley miRNAs through deep sequencing of short reads"
BMC Genomics. 12:129(2011).
|
2 |
PMID:21371551
"Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs"
Genomics. 97:282-293(2011).
|
3 |
PMID:23264558
"Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon"
Mol Plant. 6:423-443(2013).
|