![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR5073 |
|||||
Accession | MI0017946 (change log) | ||||
Description | Oryza sativa miR5073 stem-loop | ||||
Literature search |
1 open access papers mention osa-MIR5073 | ||||
Stem-loop |
--aua auua u -u uuucaauu aaagu 5' aga guuugg gaa cggaaacuauu uuauagaa c ||| |||||| ||| ||||||||||| |||||||| c 3' ucu caaacc cuu gcuuuugauaa aguauuuu a ucaaa --gc c uu ---uaacu aaugu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR5073 |
|
Accession | MIMAT0020555 |
Sequence |
11 - guuuggugaaucggaaacuauuu - 33 |
Deep sequencing | 19 reads, 2 experiments |
Evidence | not experimental |
References |
|
1 |
PMID:21352554
"Discovery of barley miRNAs through deep sequencing of short reads"
BMC Genomics. 12:129(2011).
|