Stem-loop sequence bmo-mir-3429

AccessionMI0014494 (change log)
DescriptionBombyx mori miR-3429 stem-loop
Stem-loop
   aaua   u     uu  uua   a     -a      -aaaaauauau    uu 
5'     ucu aauaa  uc   acg uuugu  guugcu           cguu  a
       ||| |||||  ||   ||| |||||  ||||||           ||||   
3'     agg uuguu  ag   ugc aaaca  cagcgg           gcaa  u
   ---a   -     uu  -ua   -     gg      gcauacacgau    ca 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582012.1: 2405754-2405855 [-]
intergenic
Database links

Mature sequence bmo-miR-3429

Accession MIMAT0015637
Sequence

5 - 

ucuuaauaauuucuuaacgauuug

 - 28

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).