Stem-loop sequence bmo-mir-3427

AccessionMI0014492 (change log)
DescriptionBombyx mori miR-3427 stem-loop
Stem-loop
   a   ucgg      a  uu       agc      uaagu        aa  aucaau 
5'  gua    uuuacc gu  agggugu   ugguga     gauuuuua  uc      u
    |||    |||||| ||  |||||||   ||||||     ||||||||  ||       
3'  cgu    agaugg cg  uuucgca   auuacu     cugaaaau  ag      g
   c   -uaa      -  -u       aau      ----u        aa  cacuau 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581716.1: 1208293-1208403 [-]
intergenic
Database links

Mature sequence bmo-miR-3427

Accession MIMAT0015635
Sequence

71 - 

uaaaagucuucauuauaaacgcu

 - 93

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).