Stem-loop sequence bmo-mir-3326

AccessionMI0014384 (change log)
DescriptionBombyx mori miR-3326 stem-loop
Stem-loop
   uga   ga       ---       g  cu      ---au          uauca 
5'    gug  cuguagg   uuuugug uu  ugugaa     auaaacacuu     c
      |||  |||||||   ||||||| ||  ||||||     ||||||||||     u
3'    cac  gacauuu   gaaacau aa  auauuu     uauuuguggg     a
   --a   -g       uug       g  ag      auggu          ucauu 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581808.1: 172351-172456 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-3326
bmo-mir-3326NW_004581808.1: 172351-172456 [+]
bmo-mir-2772bNW_004581808.1: 173498-173593 [-]
Database links

Mature sequence bmo-miR-3326

Accession MIMAT0015513
Sequence

12 - 

uagguuuugugguucuugugaaaua

 - 36

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).