Stem-loop sequence bmo-mir-3238

AccessionMI0014293 (change log)
DescriptionBombyx mori miR-3238 stem-loop
Stem-loop
   aaagucaaa   a  a  -----    g  u        ----      aaagagcuu ga     agg 
5'          uga uc ug     cauu ac acauguuu    gccaug         g  cgccg   c
            ||| || ||     |||| || ||||||||    ||||||         |  |||||    
3'          acu ag ac     guag ug uguauaaa    cggugc         c  gcggu   a
   --------a   -  a  auaug    a  u        auau      -------au ag     aaa 
Get sequence
Deep sequencing
171 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581712.1: 3566-3680 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-3238
bmo-mir-3238NW_004581712.1: 3566-3680 [+]
bmo-mir-2998NW_004581712.1: 4762-4856 [+]
Database links

Mature sequence bmo-miR-3238

Accession MIMAT0015421
Sequence

7 - 

aaaugaaucaugcauugacuacaug

 - 31

Get sequence
Deep sequencing34 reads, 3 experiments
Evidence experimental; SOLID [1]
Database links

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).