Stem-loop sequence tgu-mir-24

AccessionMI0013753 (change log)
DescriptionTaeniopygia guttata miR-24 stem-loop
Gene family MIPF0000041; mir-24
Literature search

1 open access papers mention tgu-mir-24
(5 sentences)

Stem-loop 
   ccagucggaaacaacuuacagcugcugcuguuguuccaggcuguugau  a c  uc    g  g   a         ua     uc  au 
5'                                                 gg c cg  cucc gu ccu cugagcuga  ucagu  ug  u
                                                   || | ||  |||| || ||| |||||||||  |||||  ||   
3'                                                 cc g gc  gagg ca gga gacuugacu  gguca  ac  u
   ------------------------------------------------  - a  -u    a  a   c         -c     -c  au
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chrZ: 9899801-9899932 [-]
intergenic
Clustered miRNAs
< 10kb from tgu-mir-24
tgu-mir-23chrZ: 9900645-9900715 [-]
tgu-mir-27chrZ: 9900324-9900414 [-]
tgu-mir-24chrZ: 9899801-9899932 [-]
Database links

Mature sequence tgu-miR-24-5p

Accession MIMAT0026994
Sequence

63 -  

gugccuacugagcugauaucagu

 - 85

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-24-3p

Accession MIMAT0014539
Sequence

101 -  

uggcucaguucagcaggaacag

 - 122

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).