Stem-loop sequence bmo-mir-2774c

AccessionMI0012450 (change log)
DescriptionBombyx mori miR-2774c stem-loop
Gene family MIPF0000829; mir-2774
Literature search

1 open access papers mention bmo-mir-2774c
(2 sentences)

Stem-loop
   aac   a  auuc   cc   gg     a    aaua 
5'    aac ac    gga  guc  ucuau gagc    u
      ||| ||    |||  |||  ||||| ||||     
3'    uug ug    ccu  cag  aggug cucg    c
   cua   c  cuuc   uc   -a     g    ccca 
Get sequence
Deep sequencing
336 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582021.1: 6246323-6246397 [-]
intergenic
Database links

Mature sequence bmo-miR-2774c

Accession MIMAT0013759
Sequence

45 - 

cucgguggaagaccuucccuu

 - 65

Get sequence
Deep sequencing222 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).