Stem-loop sequence bmo-mir-2775b

AccessionMI0012429 (change log)
DescriptionBombyx mori miR-2775b stem-loop
Stem-loop
   aa                     c          aaaa 
5'   gggagaaaaguaggacguuuc ucccgcgugu    u
     ||||||||||||||||||||| ||||||||||     
3'   cccuuuuuucauccuguagag agggcgcaca    u
   cg                     u          aacu 
Get sequence
Deep sequencing
67 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581704.1: 1278700-1278777 [-]
intergenic
Database links

Mature sequence bmo-miR-2775b

Accession MIMAT0013745
Sequence

11 - 

aguaggacguuuccucccgcgug

 - 33

Get sequence
Deep sequencing46 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).