Stem-loop sequence bmo-mir-2807a-6

AccessionMI0012416 (change log)
DescriptionBombyx mori miR-2807a-6 stem-loop
Gene family MIPF0000826; mir-2807
Stem-loop
   agcguaa    a           g          uu     -au  u 
5'        aacu aaauuuguaug aguuggaacg  ugcuu   gu u
          |||| ||||||||||| ||||||||||  |||||   || g
3'        uuga uuuaaacauac ucgaccuugu  gcggg   ca c
   uuuucaa    c           g          -c     gau  c 
Get sequence
Deep sequencing
108 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581701.1: 620630-620724 [+]
intergenic
Database links

Mature sequence bmo-miR-2807a

Accession MIMAT0013716
Sequence

64 - 

uuccagcugcauacaaauuuca

 - 85

Get sequence
Deep sequencing126 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).