Stem-loop sequence bmo-mir-2808a-2

AccessionMI0012381 (change log)
DescriptionBombyx mori miR-2808a-2 stem-loop
Gene family MIPF0000836; mir-2808
Literature search

1 open access papers mention bmo-mir-2808a-2
(1 sentences)

Stem-loop
   -------gga                             ga 
5'           cgugcuucguagaaucuaccaucggaucg  a
             |||||||||||||||||||||||||||||   
3'           gcaugaagcgucuuagaugguggccuagc  a
   aucguucucg                             gc 
Get sequence
Deep sequencing
838 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581679.1: 1828705-1828781 [+]
intergenic
Database links

Mature sequence bmo-miR-2808a-5p

Accession MIMAT0013711
Previous IDsbmo-miR-2808a
Sequence

11 - 

cguagaaucuaccaucggaucg

 - 32

Get sequence
Deep sequencing232 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence bmo-miR-2808a-3p

Accession MIMAT0013712
Previous IDsbmo-miR-2808a*
Sequence

44 - 

cggugguagauucugcgaaguacg

 - 67

Get sequence
Deep sequencing667 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).