Stem-loop sequence bmo-mir-2778a-1

AccessionMI0012338 (change log)
DescriptionBombyx mori miR-2778a-1 stem-loop
Gene family MIPF0000827; mir-2778
Stem-loop
   --    g     --          a  uc    ac  uuu 
5'   cacg caaaa  guuuuuuugc ua  cugc  ag   c
     |||| |||||  |||||||||| ||  ||||  ||    
3'   gugc guuuu  caaaaaaacg au  gacg  uc   a
   ga    a     aa          c  ga    -c  uug 
Get sequence
Deep sequencing
26082 reads, 4.37e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581697.1: 2278993-2279069 [+]
intergenic
NW_004607716.1: 63-139 [-]
intergenic
NW_004607716.1: 214-290 [-]
intergenic
NW_004607716.1: 516-592 [-]
intergenic
NW_004607897.1: 67-143 [-]
intergenic
NW_004612518.1: 71-147 [+]
intergenic
NW_004612518.1: 222-298 [+]
intergenic
NW_004612518.1: 373-449 [+]
intergenic
NW_004612518.1: 524-600 [+]
intergenic
NW_004617724.1: 58-134 [+]
intergenic
NW_004617724.1: 209-285 [+]
intergenic
NW_004617724.1: 360-436 [+]
intergenic
NW_004617724.1: 511-587 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2778a-1
bmo-mir-2778a-1NW_004581697.1: 2278993-2279069 [+]
bmo-mir-2778cNW_004581697.1: 2279582-2279658 [+]
bmo-mir-2778a-3NW_004581697.1: 2279733-2279809 [+]
Database links

Mature sequence bmo-miR-2778a-5p

Accession MIMAT0013664
Previous IDsbmo-miR-2778a*
Sequence

11 - 

guuuuuuugcauauccugca

 - 30

Get sequence
Deep sequencing3118 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence bmo-miR-2778a-3p

Accession MIMAT0013665
Previous IDsbmo-miR-2778a
Sequence

46 - 

cagaguacgcaaaaaaacaauu

 - 67

Get sequence
Deep sequencing98079 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).