Stem-loop sequence bmo-mir-2777

AccessionMI0012336 (change log)
DescriptionBombyx mori miR-2777 stem-loop
Stem-loop
   cgaaa   -     g     g    g  ua     gug 
5'      ccc cuagg accuu ccug gu  ucucg   u
        ||| ||||| ||||| |||| ||  |||||    
3'      ggg gauuc uggag ggac cg  agagc   c
   cgcag   u     g     g    g  --     agg 
Get sequence
Deep sequencing
281 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581752.1: 513746-513820 [-]
intergenic
Database links

Mature sequence bmo-miR-2777-5p

Accession MIMAT0013662
Previous IDsbmo-miR-2777
Sequence

11 - 

agggaccuugccuggguuau

 - 30

Get sequence
Deep sequencing247 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence bmo-miR-2777-3p

Accession MIMAT0013663
Previous IDsbmo-miR-2777*
Sequence

45 - 

agagcgcaggggaggugcuuag

 - 66

Get sequence
Deep sequencing34 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).