Stem-loop sequence bmo-mir-2776

AccessionMI0012334 (change log)
DescriptionBombyx mori miR-2776 stem-loop
Stem-loop
   cuccuauuaga    ac        a      -  uu 
5'            gagu  gcaaaaaa caauuu gg  u
              ||||  |||||||| |||||| ||   
3'            cucg  cguuuuuu guuaaa cc  u
   aucuacuauua    aa        c      g  ca 
Get sequence
Deep sequencing
22006 reads, 3.97e+03 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581721.1: 2005014-2005088 [+]
intergenic
Database links

Mature sequence bmo-miR-2776

Accession MIMAT0013660
Sequence

11 - 

agaguacgcaaaaaaacaauu

 - 31

Get sequence
Deep sequencing22005 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).