Stem-loop sequence bmo-mir-2769

AccessionMI0012325 (change log)
DescriptionBombyx mori miR-2769 stem-loop
Stem-loop
   u    u  a        c             c   aug 
5'  aaau ac cgaccgaa aucugauaauaua uau   a
    |||| || |||||||| ||||||||||||| |||    
3'  uuua ug gcuggcuu uagacuauuauau aua   u
   u    u  c        u             a   gua 
Get sequence
Deep sequencing
661 reads, 66.7 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581868.1: 149776-149853 [+]
intergenic
Database links

Mature sequence bmo-miR-2769

Accession MIMAT0013650
Sequence

47 - 

auauauuaucagauuuucgguc

 - 68

Get sequence
Deep sequencing659 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).