Stem-loop sequence bmo-mir-2759

AccessionMI0012313 (change log)
DescriptionBombyx mori miR-2759 stem-loop
Stem-loop
   uu   u   ucuc        uua   ac      - u 
5'   caa gac    cguguucu   auc  ucaaga c u
     ||| |||    ||||||||   |||  |||||| |  
3'   guu cug    gcguaaga   uag  aguucu g a
   au   c   uaaa        uac   aa      u u 
Get sequence
Deep sequencing
217 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581721.1: 1233366-1233442 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2759
bmo-mir-2792NW_004581721.1: 1233111-1233191 [+]
bmo-mir-2759NW_004581721.1: 1233366-1233442 [+]
Database links

Mature sequence bmo-miR-2759

Accession MIMAT0013631
Sequence

46 - 

ugaaagaucauagaaugcgaaa

 - 67

Get sequence
Deep sequencing216 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).