Stem-loop sequence bmo-mir-2754

AccessionMI0012301 (change log)
DescriptionBombyx mori miR-2754 stem-loop
Stem-loop
   u   uu     a      uacg         ---ucaaaag    uu uu 
5'  ggg  uggac uguugc    caaugccgg          cgcg  g  a
    |||  ||||| ||||||    |||||||||          ||||  |   
3'  ccu  auuug auaaug    guuaugguc          gcgu  c  a
   a   cu     -      -uca         ucacucuaca    gu ua 
Get sequence
Deep sequencing
43 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581759.1: 32966-33062 [-]
intergenic
Database links

Mature sequence bmo-miR-2754

Accession MIMAT0013614
Sequence

68 - 

ucugguauugacuguaauag

 - 87

Get sequence
Deep sequencing36 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).