Stem-loop sequence bmo-mir-iab-4

AccessionMI0010005 (change log)
DescriptionBombyx mori miR-iab-4 stem-loop
Gene family MIPF0000151; mir-iab-4
Stem-loop
   gc    c       -            u    c   a u   cg 
5'   gucg cuucugu acguauacugaa guau cug g gcg  a
     |||| ||||||| |||||||||||| |||| ||| | |||  u
3'   cagu gaagaca ugcauaugacuu caua ggc c ugu  u
   ca    a       a            c    u   - -   uc 
Get sequence
Deep sequencing
647 reads, 66.7 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582018.1: 3486590-3486677 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-iab-4
bmo-mir-iab-4NW_004582018.1: 3486590-3486677 [+]
bmo-mir-iab-8NW_004582018.1: 3486590-3486677 [-]
Database links

Mature sequence bmo-miR-iab-4-5p

Accession MIMAT0009162
Sequence

15 - 

acguauacugaauguauccuga

 - 36

Get sequence
Deep sequencing610 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence bmo-miR-iab-4-3p

Accession MIMAT0009163
Sequence

53 - 

cgguauaccuucaguauacguaac

 - 76

Get sequence
Deep sequencing37 reads, 3 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).