Stem-loop sequence bmo-mir-929

AccessionMI0010001 (change log)
DescriptionBombyx mori miR-929 stem-loop
Gene family MIPF0000447; mir-929
Literature search

1 open access papers mention bmo-mir-929
(1 sentences)

   --------------------u     a       uag         -  u 
5'                      guuaa uugacuc   uagggaguc cg u
                        ||||| |||||||   ||||||||| || c
3'                      caguu gacugag   aucccucag gc c
   gcagcuaaaucguaguuucuu     g       cua         c  g 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582032.1: 396204-396285 [+]
Database links

Mature sequence bmo-miR-929-5p

Accession MIMAT0009158
Previous IDsbmo-miR-929

7 - 


 - 27

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence bmo-miR-929-3p

Accession MIMAT0015289
Previous IDsbmo-miR-929*

39 - 


 - 60

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]


PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).