Stem-loop sequence bmo-mir-1923

AccessionMI0008393 (change log)
DescriptionBombyx mori miR-1923 stem-loop
Gene family MIPF0000930; mir-1923
Literature search

2 open access papers mention bmo-mir-1923
(2 sentences)

Stem-loop
   ---------------------------------------------------------     acu      u 
5'                                                          ucgaa   ugccau u
                                                            |||||   |||||| a
3'                                                          agcuu   guggua a
   ggcggugccgauacguugccaugcgcuaaucaguaauuuuuaauuacuuuuuucaau     -cc      a 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004590653.1: 148-236 [-]
intergenic
NW_004600947.1: 15-103 [-]
intergenic
NW_004608512.1: 100-188 [-]
intergenic
Database links

Mature sequence bmo-miR-1923

Accession MIMAT0007932
Sequence

60 - 

uaaucgcguaccguugcauagccguggc

 - 87

Get sequence
Deep sequencing27 reads, 3 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).