![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mtr-MIR396a |
||||||
Accession | MI0005621 (change log) | |||||
Description | Medicago truncatula miR396a stem-loop | |||||
Gene family | MIPF0000047; MIR396 | |||||
Literature search |
4 open access papers mention mtr-MIR396a | |||||
Stem-loop |
ugc a uucguau -a gu 5' uuuuccacagcuuucuuga cuucu cuu aaucu u ||||||||||||||||||| ||||| ||| ||||| u 3' agagggugucgaaagaacu gaaga gaa uuaga u aua c ---uccu aa ac |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mtr-miR396a-5p |
|
Accession | MIMAT0011107 |
Previous IDs | mtr-miR396a |
Sequence |
6 - uuccacagcuuucuugaacuu - 26 |
Evidence | experimental; 454 [2], Illumina [4] |
Mature sequence mtr-miR396a-3p |
|
Accession | MIMAT0026456 |
Sequence |
70 - gcucaagaaagcugugggaga - 90 |
Evidence | experimental; Illumina [3-4] |
References |
|
1 |
"
Unpublished (2007).
|
2 |
PMID:19555436
"Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families"
New Phytol. 184:85-98(2009).
|
3 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|
4 |
PMID:23572382
"microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula"
Planta. 238:91-105(2013).
|