Stem-loop sequence mtr-MIR396a

AccessionMI0005621 (change log)
DescriptionMedicago truncatula miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

4 open access papers mention mtr-MIR396a
(9 sentences)

Stem-loop 
   ugc                   a     uucguau   -a     gu 
5'    uuuuccacagcuuucuuga cuucu       cuu  aaucu  u
      ||||||||||||||||||| |||||       |||  |||||  u
3'    agagggugucgaaagaacu gaaga       gaa  uuaga  u
   aua                   c     ---uccu   aa     ac
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 39789612-39789704 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR396a
mtr-MIR396achr4: 39789612-39789704 [+]
mtr-MIR396bchr4: 39798253-39798347 [-]
Database links

Mature sequence mtr-miR396a-5p

Accession MIMAT0011107
Previous IDsmtr-miR396a
Sequence

6 -  

uuccacagcuuucuugaacuu

 - 26

Get sequence
Evidence experimental; 454 [2], Illumina [4]

Mature sequence mtr-miR396a-3p

Accession MIMAT0026456
Sequence

70 -  

gcucaagaaagcugugggaga

 - 90

Get sequence
Evidence experimental; Illumina [3-4]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).
3
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
4
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).