Stem-loop sequence gga-mir-16-1

AccessionMI0001185 (change log)
DescriptionGallus gallus miR-16-1 stem-loop
Gene family MIPF0000006; mir-15
Literature search

22 open access papers mention gga-mir-16-1
(227 sentences)

Stem-loop
   gucu   a    c         -  a        u uuaaaac 
5'     guc uacu uagcagcac gu aauauugg g       u
       ||| |||| ||||||||| || |||||||| |        
3'     cgg auga gucgucgug ca uuaugacc c       g
   ---u   a    a         u  a        u uauaaau 
Get sequence
Deep sequencing
181880 reads, 2.34e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 169399051-169399134 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-16-1
gga-mir-15achr1: 169399193-169399275 [-]
gga-mir-16-1chr1: 169399051-169399134 [-]
Database links

Mature sequence gga-miR-16-5p

Accession MIMAT0001116
Sequence

14 - 

uagcagcacguaaauauuggug

 - 35

Get sequence
Deep sequencing362642 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence gga-miR-16-1-3p

Accession MIMAT0026500
Sequence

54 - 

ccaguauuaacugugcugcugaa

 - 76

Get sequence
Deep sequencing589 reads, 5 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).