miRBase entry: hsa-mir-224

Stem-loop hsa-mir-224


Accession
MI0000301
Symbol
HGNC: MIR224
Description
Homo sapiens hsa-mir-224 precursor miRNA
Gene family
MIPF0000088; mir-224

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR224 is a microRNA that has been implicated in various biological processes and diseases. It has been shown to be up-regulated in siAQP4 treated animals, leading to a reduction in Cx43 expression [PMC5843607]. Estradiol (E2) is known to play a crucial role in the regulation of MIR224, and it has been identified as a key regulator of MIR224 in both esophageal adenocarcinoma (EA) and esophageal squamous cell carcinoma (ESCC) [PMC6609598]. In addition, MIR224 has been identified as a potential biomarker for EA [PMC6609598]. Aberrant expression of miRNAs, including MIR224, has also been observed in autoimmune diseases such as lupus erythematosus [PMC5351619]. MIR224 is one of the miRNAs involved in the progression of pancreatic adenocarcinoma (PAAD) [PMC6005310]. It also plays a critical role in chemoresistance in ovarian cancer cells by regulating the PRKCD pathway [PMC8071157]. Furthermore, MIR224 targets glycine methyltransferases and is involved in epithelial-mesenchymal transition (EMT) regulation in colorectal cancer [PMC9775527] [PMC5240405]. It has also been implicated as a prognostic candidate for colorectal cancer [PMC5935085]. Additionally, MIR224 is overexpressed in WNT medulloblastomas and promotes migration of hepatocellular carcinoma (HCC) and colorectal cancer (CRC) by binding to Smad4 and HOXD10 proteins [PMC4333163] [PMC5226496]. Furthermore, it regulates NCR1 expression levels and plays a role in post-stroke angiogenesis processes along with other miRNAs such as miR225, miR335, and miR139-5p [PMC9166526] [PMC6732937].

Literature search
123 open access papers mention hsa-mir-224
(843 sentences)

Sequence

19600 reads, 734 reads per million, 116 experiments
gggcuuUCAAGUCACUAGUGGUUCCGUUUAGuagaugauugugcauuguuucAAAAUGGUGCCCUAGUGACUACAaagccc
(((((((..(((((((((.(((.((((((.(.(((((((.....)))))))).)))))).))))))))))))..)))))))

Structure
       CA         U   U      A u       u 
gggcuuU  AGUCACUAG GGU CCGUUU G agaugau g
|||||||  ||||||||| ||| |||||| | ||||||| u
cccgaaA  UCAGUGAUC CCG GGUAAA c uuuguua g
       CA         -   U      A -       c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 151958578-151958658 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-224
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-224 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-224 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-224 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-224-5p

Accession MIMAT0000281
Description Homo sapiens hsa-miR-224-5p mature miRNA
Sequence 7 - UCAAGUCACUAGUGGUUCCGUUUAG - 31
Evidence experimental
cloned [1-4]
Database links
Predicted targets

Mature hsa-miR-224-3p

Accession MIMAT0009198
Description Homo sapiens hsa-miR-224-3p mature miRNA
Sequence 53 - AAAAUGGUGCCCUAGUGACUACA - 75
Evidence experimental
qRT-PCR [5], 454 [6]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 19015728
    MicroRNA expression patterns and function in endodermal differentiation of human embryonic stem cells
    Tzur G, Levy A, Meiri E, Barad O, Spector Y, Bentwich Z, Mizrahi L, Katzenellenbogen M, Ben-Shushan E, Reubinoff BE, Galun E
    PLoS One (2008) 3:e3726

  5. PubMed ID: 19144710
    Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
    "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
    "J Virol (2009) 83:3333-3341

  6. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706