![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-106a |
||||||||||||||
Accession | MI0000113 (change log) | |||||||||||||
Previous IDs | hsa-mir-106-X;hsa-mir-106 | |||||||||||||
Symbol | HGNC:MIR106A | |||||||||||||
Description | Homo sapiens miR-106a stem-loop | |||||||||||||
Gene family | MIPF0000001; mir-17 | |||||||||||||
Literature search |
![]()
256 open access papers mention hsa-mir-106a | |||||||||||||
Stem-loop |
u cc - g g c u 5' cc ugg auguaa aagugcuuaca ugcag uag uu u || ||| |||||| ||||||||||| ||||| ||| || u 3' gg acc uacauu uucacgaaugu acguc auc ag g u au c a - u a |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Comments |
This miRNA was not cloned in reference [1], rather it was identified by homology to miR-91 (MI0000071). This sequence is localised to chromosome X and was named mir-106-X in [1]. Mouse and human miR-106a (MI0000406 and MI0000113) differ at two positions but the precursor sequences are clearly closely related. The sequences are also related to mir-17 (MI0000071 and MI0000687). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
|||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence hsa-miR-106a-5p |
|
Accession | MIMAT0000103 |
Previous IDs | hsa-miR-106a |
Sequence |
13 - aaaagugcuuacagugcagguag - 35 |
Deep sequencing | 2188147 reads, 159 experiments |
Evidence | experimental; cloned [2-3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-106a-3p |
|
Accession | MIMAT0004517 |
Previous IDs | hsa-miR-106a* |
Sequence |
50 - cugcaauguaagcacuucuuac - 71 |
Deep sequencing | 5556 reads, 110 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
2 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|