Mature sequence bta-miR-12005

Accession numberMIMAT0046666
IDbta-miR-12005
Stem-Loop bta-mir-12005-1 bta-mir-12005-2
Sequence
augaaguccuuaaggggagggu
Get sequence
Deep sequencing22 reads, 9 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).