Accession | MIMAT0000237 |
Description | mmu-miR-204-5p mature miRNA |
Hairpins | |
Sequence | UUCCCUUUGUCAUCCUAUGCCU |
Evidence |
experimental
cloned [1-3], Illumina [4-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26298346 | has_input UniProtKB:Q62315 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26298346 | has_input UniProtKB:Q62315 |
involved_in | GO:0043537 negative regulation of blood vessel endothelial cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28901393 | |
involved_in | GO:0060045 positive regulation of cardiac muscle cell proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26298346 | acts_on_population_of CL:0002495 |