Accession | MIMAT0000165 |
Description | mmu-miR-155-5p mature miRNA |
Hairpins | |
Sequence | UUAAUGCUAAUUGUGAUAGGGGU |
Evidence |
experimental
cloned [1,3], Illumina [5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0002686 negative regulation of leukocyte migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26931072 | occurs_in UBERON:0000948 |
acts_upstream_of | GO:0002696 positive regulation of leukocyte activation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22715471 | |
acts_upstream_of | GO:0002718 regulation of cytokine production involved in immune response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25219837 | |
acts_upstream_of | GO:0010613 positive regulation of cardiac muscle hypertrophy |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24657879 | |
acts_upstream_of | GO:0010744 positive regulation of macrophage derived foam cell differentiation |
ECO:0000305 curator inference used in manual assertion |
PMID:24675724 | |
acts_upstream_of | GO:0010759 positive regulation of macrophage chemotaxis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25850724 | results_in_movement_of CL:0002476 |
acts_upstream_of | GO:0032370 None |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24675724 | occurs_in CL:0000235 |
acts_upstream_of | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25219837 | |
acts_upstream_of | GO:0032696 negative regulation of interleukin-13 production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26931072 | |
acts_upstream_of | GO:0032713 negative regulation of interleukin-4 production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26931072 | |
acts_upstream_of | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25219837 | |
acts_upstream_of | GO:0032729 positive regulation of type II interferon production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26931072 | |
acts_upstream_of | GO:0042102 positive regulation of T cell proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26931072 | |
acts_upstream_of | GO:0042127 regulation of cell population proliferation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:25810298 | |
acts_upstream_of | GO:0042532 negative regulation of tyrosine phosphorylation of STAT protein |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26931072 | |
acts_upstream_of | GO:0042981 regulation of apoptotic process |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:25810298 | |
acts_upstream_of | GO:0043030 regulation of macrophage activation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26931072 | |
acts_upstream_of | GO:0043032 positive regulation of macrophage activation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22715471 | |
acts_upstream_of | GO:0046426 negative regulation of receptor signaling pathway via JAK-STAT |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:27829437 | |
acts_upstream_of | GO:0048146 positive regulation of fibroblast proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26589288 | |
acts_upstream_of | GO:0048711 positive regulation of astrocyte differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26134658 | |
acts_upstream_of | GO:0050729 positive regulation of inflammatory response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22715471 | |
acts_upstream_of | GO:0050729 positive regulation of inflammatory response |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:25381879 | occurs_in CL:0000576 |
acts_upstream_of | GO:0050729 positive regulation of inflammatory response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26134658 | |
acts_upstream_of | GO:0050729 positive regulation of inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26249758 | occurs_in UBERON:0000948 |