miRBase entry: gma-MIR4996

Stem-loop gma-MIR4996


Accession
MI0017862
Description
Glycine max gma-MIR4996 precursor miRNA

Literature search
4 open access papers mention gma-MIR4996
(6 sentences)

Sequence


uuucuccuaacuuugagagcauggguaacuucuauuuuuuuggcgcuguccccuucuccaucaucuuuacuucaaccuuuaaacuuccuuuuucaacuauuaaaauuccugacuauguugaggaaauuaagaaaauggguuuguugccgaugccagcagaaUAGAAGCUCCCCAUGUUCUCaccguuagc
......(((((..((((((((((((...((((((((((.(((((((.((......(.((((..((((..(((((((........................................))))))).....))))..)))))......)).).)))))).))))))))))...))))))))))))..))))).

Structure
uuucuc     uu            uaa          u      - u  ccccuu u    ca    ---ua       cuuuaaacuuccuuuuuca 
      cuaac  ugagagcauggg   cuucuauuuu uuggcg c gu      c ccau  ucuu     cuucaac                   a
      |||||  ||||||||||||   |||||||||| |||||| | ||      | ||||  ||||     |||||||                    
      gauug  aCUCUUGUACCC   GAAGAUaaga gaccgu g cg      g ggua  agaa     ggaguug                   c
-----c     cc            CUC          c      a c  uuguuu -    aa    uuaaa       uaucaguccuuaaaauuau 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr15: 5437428-5437617 [+]

Database links

Mature gma-miR4996

Accession MIMAT0021014
Description Glycine max gma-miR4996 mature miRNA
Sequence 162 - UAGAAGCUCCCCAUGUUCUC - 181
Evidence experimental
454 [1], Illumina [2-3]

References

  1. PubMed ID: 21504877
    MicroRNAs in the shoot apical meristem of soybean
    "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
    "J Exp Bot (2011) 62:2495-2506

  2. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553

  3. PubMed ID: 24475082
    Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
    Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
    PLoS One (2014) 9:e86153