Stem-loop gma-MIR1507c

Accession

MI0017854

Description

Glycine max gma-MIR1507c precursor miRNA

Literature search

17 open access papers mention gma-MIR1507c
(39 sentences)

Sequence

ugcuaGAGGUGUUUGGGAUGAGAGAAuagaauuuuuucaaaugcuugaaagugaucucuucCCUCAUUCCAAACAUCAUCUaacacacau
((.(((((((((((((((((((.(((.(((...(((((((....)))))))...))).))).))))))))))))))).)))).)).....

Structure

-----  c    -               A   u   auu       a 
     ug uaGA GGUGUUUGGGAUGAG GAA aga   uuuucaa u
     || |||| ||||||||||||||| ||| |||   |||||||  
     ac aUCU CUACAAACCUUACUC cuu ucu   gaaaguu g
uacac  a    A               C   c   agu       c 

Annotation confidence Not enough data

Genome context

chr9: 17134380-17134469 [-]

Mature gma-miR1507c-5p

• Accession: MIMAT0021005
• Description: Glycine max gma-miR1507c-5p mature miRNA
• Sequence: 6 - GAGGUGUUUGGGAUGAGAGAA - 26
• Evidence: experimental ; SOLiD [2], Illumina [3-4]

Mature gma-miR1507c-3p

• Accession: MIMAT0021006
• Description: Glycine max gma-miR1507c-3p mature miRNA
• Sequence: 62 - CCUCAUUCCAAACAUCAUCU - 81
• Evidence: experimental ; 454 [1], Illumina [3,5]

References

1. PubMed ID: 21663675
   Identification of novel soybean microRNAs involved in abiotic and biotic stresses
   Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
   BMC Genomics (2011) 12:307


2. PubMed ID: 21504877
   MicroRNAs in the shoot apical meristem of soybean
   "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
   "J Exp Bot (2011) 62:2495-2506


3. PubMed ID: 21751852
   Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome
   "Radwan O, Liu Y, Clough SJ"
   "Mol Plant Microbe Interact (2011) 24:958-972


4. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553


5. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153