Stem-loop hsa-mir-4647

Accession

MI0017274

Symbol

HGNC: MIR4647

Description

Homo sapiens hsa-mir-4647 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR4647 is a non-coding RNA, specifically an intragenic microRNA, that is upregulated and resides within an upregulated gene [PMC5823624]. It is implicated in cellular processes such as migration and colony formation, as evidenced by studies optimizing the transfection of its precursors [PMC9843305]. This microRNA is located in a genomic region that also includes three protein-coding genes—HSP90AB1, SLC35B2, and NFKBIE—indicating its potential involvement in complex gene networks [PMC5069896]. Despite its upregulation, inhibition of MIR4647 does not appear to suppress the cytopathic effects of HSV-1 infection, suggesting that its role may be independent of this viral process [PMC9296583]. Interestingly, MIR4647's genomic locus overlaps with the 3′-UTR of SLC35B2, which may imply a regulatory interaction between MIR4647 and the expression of SLC35B2 [PMC9296583]. Additionally, MIR4647 has been identified as a candidate miRNA in genetic screens alongside other genes such as IRF2BPL, PAPSS1, and VANGL2 that may be relevant to cellular functions or disease mechanisms [PMC9296583].

Literature search

1 open access papers mention hsa-mir-4647
(1 sentences)

Sequence

429 reads, 30 reads per million, 38 experiments

ccaggaggguGAAGAUGGUGCUGUGCUGAGGAAaggggaugcagagcccugcccagcaccaccaccuccuaugcuccugg
(((((((.(((.((.(((((..((((((.((..((((.........)))).))))))))))))).))..))).)))))))

Structure

       g   -A  A     CU      A  AA    gau 
ccaggag guG  AG UGGUG  GUGCUG GG  aggg   g
||||||| |||  || |||||  |||||| ||  ||||   c
gguccuc uau  uc accac  cacgac cc  uccc   a
       g   cc  c     --      -  -g    gag 

Annotation confidence Not enough data

Genome context

chr6: 44254206-44254285 [-]

Disease association

hsa-mir-4647 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-4647

• Accession: MIMAT0019709
• Description: Homo sapiens hsa-miR-4647 mature miRNA
• Sequence: 11 - GAAGAUGGUGCUGUGCUGAGGAA - 33
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 21199797
   Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
   "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
   "Cancer Res (2011) 71:78-86