MIR4521 is a miRNA whose validity has been questioned and is found in miRBase [PMC5340965]. It has been identified as one of the upregulated genes in early diabetic nephropathy (DN) [PMC7759603]. In a study on colorectal cancer, high levels of MIR4521 expression were associated with poor prognosis [PMC7583989]. MIR4521 is regulated by STAT3 and was found to be overexpressed in HT29-derived tumorspheres [PMC7583989]. In the context of diabetic kidney disease (DKD), MIR4521 was identified as one of the miRNAs that may regulate differentially expressed genes (DEGs) associated with DKD pathogenesis [PMC8183707]. Additionally, a study on transfection used a pre-miR-4521 sequence for transfection purposes [PMC6754377]. In summary, MIR4521 is a miRNA whose validity has been questioned and is found in miRBase. It has been implicated in early DN and colorectal cancer prognosis. It is regulated by STAT3 and may play a role in DKD pathogenesis. The pre-miR-4521 sequence has also been used for transfection purposes.
uc U - GUGCUC ua gGC AAG GAAGUCCU AGuuuug g ||| ||| |||||||| ||||||| uug uuc cuuuagga ucaaaac c ca - u ------ ua
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0019058 |
Description | Homo sapiens hsa-miR-4521 mature miRNA |
Sequence | 4 - GCUAAGGAAGUCCUGUGCUCAG - 25 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|