MIR548AC is a microRNA located within the first intron of the CD58 gene, which has been implicated in immunological conditions, although research on its specific role is limited [PMC10061723]. The International Multiple Sclerosis Genetics Consortium (IMSGC) identified a single nucleotide polymorphism (SNP), rs1414273, within MIR548AC that may influence multiple sclerosis (MS) susceptibility due to its decoupling effect on the transcription of CD58 and MIR548AC [PMC10061723]. This SNP is also associated with changes in the stability of MIR548AC [PMC10061723]. Despite identifying six candidate MS-associated miR-SNPs, including rs1414273 in MIR548AC, further prioritization was not pursued for five of them due to either a lack of predicted structural changes or high linkage disequilibrium in the major histocompatibility complex (MHC) locus [PMC10061723'>PMC10061723]. However, rs1414273 was prioritized based on structural and functional predictions that suggest the risk allele may lead to increased levels of MIR548AC [PMC10061723]. The prioritization process underscored rs1414273 as a notable candidate SNP for MS among other potential candidates identified by IMSGC [PMC10061723].
g u - uu uauuagguuggugcaaaagu auugu gguuuuugcuauu u |||||||||||||||||||| ||||| ||||||||||||| u augauccaaucacGUUUUCA UAACG CCAAAAACgguaa u g U G uu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0018938 |
| Description | Homo sapiens hsa-miR-548ac mature miRNA |
| Sequence | 53 - CAAAAACCGGCAAUUACUUUUG - 74 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|