Stem-loop hsa-mir-3916

Accession

MI0016422

Symbol

HGNC: MIR3916

Description

Homo sapiens hsa-mir-3916 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR3916 is a microRNA that has been found to be positively correlated with genes B3GALT2, CDH10, NELL1, OCLM, PRKAR2B, TREM1, and USP46, and negatively correlated with genes AEBP1, CDH6, HSD17B2, LUM, MS4A4A, PTN and RASSF9 [PMC8325821]. While TREM-1 has been implicated in high-glucose-induced macrophage phenotypic transformation in diabetic kidney disease (DKD), there is no reported evidence on the involvement of CDH10, MIR3916 or the other genes in DKD [PMC8325821]. In a study on mismatch repair (MMR) patients and MMR+ patients, MIR3916 was found to be highly expressed in MMR+ patients [PMC6036478]. Additionally, MIR3916 has been identified as a regulator of desmosome destabilization during aging by targeting JUP,DSC2 and DSP genes [PMC8282276]. Furthermore,MIR3916 has been implicated in the regulation of calcium handling through its targeting of ATP2A2 (SERCA2) and CASQ2 genes [PMC8282276]. In fact,MIR3916 was found to have the largest contribution in potentially regulating 63% of cardiac genes across various functional categories [PMC8282276]. Lastly,TNNC1,TNNT2 ,ACTN2 ,ACTC1 ,and TPM1 have also been identified as mirror targets of hsa‐mir‐6080 and MIR3916[PMC8282276].

Literature search

1 open access papers mention hsa-mir-3916
(1 sentences)

Sequence

321 reads, 346 reads per million, 48 experiments

aucccagagaagaaggaagAAGAGGAAGAAAUGGCUGGUUCUCAGgugaaugugucuggguucaggggaugugucuccucuuuucuucugggau
((((((((......((((((.(((((.((.....((((..((((((........)))))).))))........)))))))))))))))))))))

Structure

        gaagaa      A     A  ---AAUGG    UU      uga 
aucccaga      ggaagA GAGGA GA        CUGG  CUCAGg   a
||||||||      |||||| ||||| ||        ||||  ||||||    
uagggucu      ucuuuu cuccu cu        gacu  gggucu   u
        ------      -     -  guguaggg    -u      gug 

Annotation confidence Not enough data

Genome context

chr1: 247201967-247202060 [-]

Disease association

hsa-mir-3916 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-3916

• Accession: MIMAT0018190
• Description: Homo sapiens hsa-miR-3916 mature miRNA
• Sequence: 20 - AAGAGGAAGAAAUGGCUGGUUCUCAG - 45
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 20224791
   Discovery of novel microRNAs in female reproductive tract using next generation sequencing
   Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH
   PLoS One (2010) 5:e9637