miRBase entry: hsa-mir-4324

Stem-loop hsa-mir-4324


Accession
MI0015854
Symbol
HGNC: MIR4324
Description
Homo sapiens hsa-mir-4324 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR4324 is a microRNA whose expression in thyroid carcinoma patients had not been previously described before a recent study [PMC9221779]. This study found that MIR4324, along with other miRNAs, could enhance the diagnostic accuracy of fine-needle thyroid node biopsies, distinguishing malignant from benign thyroid nodules [PMC9221779]. Notably, a higher expression of MIR4324 is linked to papillary carcinoma that extends beyond the thyroid gland [PMC9221779]. The study revealed that an increase in MIR4324 expression significantly raises the likelihood of the disease being cancerous with metastasis [PMC9221779'>PMC9221779]. The diagnostic accuracy of MIR4324 was confirmed through ROC curve analysis, which showed it was effective in identifying patients with papillary thyroid carcinoma (PTC) [PMC9221779]. Furthermore, RT-PCR analysis confirmed higher relative expression levels of MIR4324 in PTC compared to benign nodules [PMC9221779]. Contrary to the original summary, the study actually found that patients with PTC with lymph node metastasis (LNM) had significantly higher levels of MIR4324 compared to those with PTC without LNM [PMC9221779], suggesting its potential role in assessing the risk and prognosis of thyroid carcinoma.


Sequence

31 reads, 22 reads per million, 9 experiments
cggccccuuuguuaagggucucagcuccagggaacuuuaaaaCCCUGAGACCCUAACCUUAAaggugcugca
((((.(((((((((.(((((((((.....((...........)))))))))))))))...))))).))))..

Structure
--    c     ---    a         cucca  gaac 
  cggc ccuuu   guua gggucucag     gg    u
  |||| |||||   |||| |||||||||     ||    u
  gucg ggaAA   CAAU CCCAGAGUC     CC    u
ac    u     UUC    -         -----  aaaa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr19: 49308797-49308868 [-]

Disease association
hsa-mir-4324 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4324

Accession MIMAT0016876
Description Homo sapiens hsa-miR-4324 mature miRNA
Sequence 43 - CCCUGAGACCCUAACCUUAA - 62
Evidence experimental
SOLiD [1]
Database links
Predicted targets

References

  1. PubMed ID: 19784364
    Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors
    Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP
    PLoS One (2009) 4:e7192