miRBase entry: hsa-mir-3188

Stem-loop hsa-mir-3188


Accession
MI0014232
Symbol
HGNC: MIR3188
Description
Homo sapiens hsa-mir-3188 precursor miRNA mir-3188
Gene
family?
RF03451; mir-3188

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR3188 is a microRNA that has been found to regulate the mTOR and PI3K/AKT pathway involved in insulin signaling in endothelial cells [PMC8673831]. The reduced expression of MIR3188, due to the presence of rs7247237, has been associated with the development of type 2 diabetes mellitus (T2DM) [PMC8673831]. In nasopharyngeal carcinoma (NPC), MIR3188 is one of the downregulated miRNAs, and its decreased expression is associated with a good prognosis [PMC6368411]. Additionally, MIR3188 has been identified as a potential therapeutic target for non-small cell lung cancer (NSCLC) treatment [PMC6297856]. The functional importance of MIR3188 has been inferred using a systems biology tool called miRUPnet, which revealed that its target genes are critical in several cancer pathways and its most significant gene ontology term is chromatin binding [PMC4371809]. In iAs-T cells, the gene expression levels of OPN3 and MIR3188 were upregulated, but they were downregulated in iAs-Rev cells [PMC4371809]. Common genes found in all three conditions include microfibrillar associated protein 5 (MFAP5), phospholipase C-like 1 (PLCL1), opsin 3 (OPN3), and peroxisomal biogenesis factor 11 alpha (PEX11A) [PMC4371809]. Overall, MIR3188 plays important roles in insulin signaling, cancer prognosis, and potential therapeutic strategies for T2DM, NPC, NSCLC treatment. Accurate identification and quantification of intracellular MIR3188 are crucial for further research and prognosis of NPC [PMC8695942].

Literature search
2 open access papers mention hsa-mir-3188
(3 sentences)

Sequence

274 reads, 36 reads per million, 48 experiments
ggcgccuccugcucugcugugccgccagggccuccccuagcgcgccuucuggAGAGGCUUUGUGCGGAUACGGGGcuggaggccu
...((((((.((((((.(((.(((((((((((((.((.((........)))).))))))))).))))))))))))).))))))..

Structure
ggc      u      c   g    -         c  u  cgc 
   gccucc gcucug ugu ccgc cagggccuc cc ag   g
   |||||| |||||| ||| |||| ||||||||| || ||    
   cggagg cGGGGC AUA GGCG GUUUCGGAG gg uc   c
-uc      u      -   -    U         A  -  uuc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr19: 18282077-18282161 [+]

Database links

Mature hsa-miR-3188

Accession MIMAT0015070
Description Homo sapiens hsa-miR-3188 mature miRNA
Sequence 53 - AGAGGCUUUGUGCGGAUACGGGG - 75
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20300190
    Characterization of the Melanoma miRNAome by Deep Sequencing
    "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
    "PLoS One (2010) 5:e9685