MIR3158-2 is a microRNA implicated in the genetic region associated with Split-Hand/Foot Malformation (SHFM), a congenital limb disorder [PMC5003447]. This microRNA is entirely encompassed within a deletion region that also includes parts of the DPCD and FBXW4 genes, as well as the entirety of MIR3158-1 [PMC5003447]. In SHFM cases, duplications often contain MIR3158-2 along with other genes such as LBX1, BTRC, POLL, and DPCD; these duplications are consistent across cases with microarray data and those without [PMC5003447]. Notably, in SHFM cases with two discontinuous duplications at chromosome 10q24.31–q24.32, MIR3158-2 is located in the telomeric duplicated segment along with POLL and parts of DPCD and FBXW4 [PMC5003447'>PMC5003447]. Even in Patient 18 who exhibits atypical SHFM features such as short palm, small feet, hypertelorism, intellectual disability, and obesity—a 241.59 kb duplication still includes MIR3158-2 [PMC5003447]. This suggests that MIR3158-2 may play a role in the phenotypic manifestations of SHFM whether or not classical symptoms are present [PMC5003447].
caauac auucaggccgguCCUGCAGAGAGGAAGCCCUUC c ||||||||||||||||||||||||||||||||| u uaaguccggcCAGGACGUCUCUCCUUCGGGAAg g acgaau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0015032 |
Description | Homo sapiens hsa-miR-3158-3p mature miRNA |
Sequence | 50 - AAGGGCUUCCUCUCUGCAGGAC - 71 |
Evidence |
experimental
Illumina [1-2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0019211 |
Description | Homo sapiens hsa-miR-3158-5p mature miRNA |
Sequence | 13 - CCUGCAGAGAGGAAGCCCUUC - 33 |
Evidence | not_experimental |
|