MIR3138 is a microRNA that has been implicated in nerve degeneration and regeneration in diabetic peripheral neuropathy (DPN) [PMC6615525]. The study used pyrosequencing and RT-PCR to validate changes in methylation and gene expression of DPYSL2 and MIR3138 [PMC6615525]. The researchers cross-referenced predicted and known targets of MIR3138 from miRDB and DIANA-TarBase, identifying ERBB4 as a target of MIR3138 [PMC6615525]. ERBB4 has been associated with sensory nerve loss and regeneration, suggesting a potential regulatory role for MIR3138 in DPN [PMC6615525'>PMC6615525'>PMC6615525'>PMC6615525'>PMC6615525]. The study confirmed that differential methylation seen by RRBS (reduced representation bisulfite sequencing) and pyrosequencing was associated with a decrease in MIR3138 gene expression in degenerating sural nerves [PMC6615525]. DPYSL2, NFATC1, and MIR3138 were validated using pyrosequencing and RT-PCR, suggesting that epigenetic downregulation of MIR3138 may play a role in DPN progression [PMC6615525]. The primers for DPYSL2, NFATC1, and MIR3138 were designed at the University of Michigan Epigenomics Core using a published protocol [PMC6615525]. Furthermore, the study found that MIR3138 was the most differentially methylated miRNA between degenerating nerves and regenerating nerves [PMC6615525]. DPYSL2 showed significantly higher methylation levels in the degenerating group compared to the regenerating group by pyrosequencing (p = 0.0005), similar to the results observed for MIR3138 (p = 0.0130) [PMC6615525].
c c - - gugcc cccuccucggcacuucc c accucacug cc cgg c ||||||||||||||||| | ||||||||| || ||| gggaggagccgUGAGGG G UGGAGUGAC GG GUc a A A A U agaac
Accession | MIMAT0015006 |
Description | Homo sapiens hsa-miR-3138 mature miRNA |
Sequence | 48 - UGUGGACAGUGAGGUAGAGGGAGU - 71 |
Evidence |
experimental
Illumina [1-2] |
Database links | |
Predicted targets |
|