MIR3138 is a microRNA that has been validated through pyrosequencing and RT-PCR to undergo changes in methylation and exhibit a trend for decreased gene expression in degenerating sural nerves in diabetic peripheral neuropathy (DPN) [PMC6615525]. The gene ERBB4, which is associated with sensory nerve loss and nerve regeneration, has been identified as a target of MIR3138, suggesting a regulatory role for this microRNA in nerve degeneration and regeneration in DPN [PMC6615525]. Differential methylation of MIR3138, confirmed by RRBS and pyrosequencing, is associated with its decreased expression and may contribute to the progression of DPN [PMC6615525]. Primers for MIR3138 were designed, and pyrosequencing amplicons were prepared to validate its differential methylation, which was found to be the most significant among miRNAs between degenerating and regenerating nerves [PMC6615525]. Additionally, MIR3138 has been implicated in tumor suppression, indicating its broader significance in cellular processes [PMC6615525].
c c - - gugcc cccuccucggcacuucc c accucacug cc cgg c ||||||||||||||||| | ||||||||| || ||| gggaggagccgUGAGGG G UGGAGUGAC GG GUc a A A A U agaac
Accession | MIMAT0015006 |
Description | Homo sapiens hsa-miR-3138 mature miRNA |
Sequence | 48 - UGUGGACAGUGAGGUAGAGGGAGU - 71 |
Evidence |
experimental
Illumina [1-2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|