Stem-loop hsa-mir-466

Accession

MI0014157

Symbol

HGNC: MIR466

Description

Homo sapiens hsa-mir-466 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR466 is a microRNA (miRNA) implicated in the regulation of gene expression in various biological processes, including the stress response in sorghum, where it is known to regulate serine/threonine protein kinase [PMC5360763]. In the context of age-related macular degeneration (AMD), MIR466, along with mir1186, targets five genes that show differential expression in patients: Lcp1, Nox4, Rgs5, Dst, and Cpm [PMC5429617]. Additionally, MIR466 is one of several miRNAs that have been identified to bind to the 3′ UTR region of MMP9 and potentially downregulate its expression [PMC4568920]. In cardiovascular disease models specifically related to diabetes, MIR466 has been shown to regulate matrix metalloproteinase-9 (MMP-9) and promote endothelial cell proliferation and capillary-like structure formation [PMC8355361]. Furthermore, for experimental modulation of miRNA activity in endothelial cells (ECs), a specific inhibitor for MIR466 has been developed and utilized [PMC9307898].

Literature search

18 open access papers mention hsa-mir-466
(46 sentences)

Sequence

55 reads, 26 reads per million, 22 experiments

guguguguauauguguguugcauguguguauauguguguauauauguacacAUACACAUACACGCAACACACAUauauacaugc
(((((((((((((((((((((.(((((((.((((((((........)))))))).))))))).)))))))))))))))))))))

Structure

                     a       a        uau 
guguguguauauguguguugc ugugugu uaugugug   a
||||||||||||||||||||| ||||||| ||||||||    
cguacauauaUACACACAACG ACAUACA AUAcacau   u
                     C       C        gua 

Annotation confidence Not enough data

Genome context

chr3: 31161704-31161787 [-]

Disease association

hsa-mir-466 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-466

• Accession: MIMAT0015002
• Description: Homo sapiens hsa-miR-466 mature miRNA
• Sequence: 52 - AUACACAUACACGCAACACACAU - 74
• Evidence: experimental ; Illumina [1-2]

References

1. PubMed ID: 20300190
   Characterization of the Melanoma miRNAome by Deep Sequencing
   "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
   "PLoS One (2010) 5:e9685


2. PubMed ID: 21199797
   Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
   "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
   "Cancer Res (2011) 71:78-86