Stem-loop tgu-mir-147

Accession

MI0013836

Description

Taeniopygia guttata tgu-mir-147 precursor miRNA

Gene family

MIPF0000105; mir-147

Sequence

uaguggaaucauuucugcacaaacuugacuacugaaaucaGUGUGCGGAAAUGCUUCUGCuacauuuuua
((((((((.(((((((((((..........((((....))))))))))))))).))))))))........

Structure

--------        u           aaacuugacu    a 
        uaguggaa cauuucugcac          acug a
        |||||||| |||||||||||          ||||  
        auCGUCUU GUAAAGGCGUG          UGac a
auuuuuac        C           ----------    u 

Annotation confidence Not enough data

Genome context

chr10: 10438197-10438266 [+]

Mature tgu-miR-147

• Accession: MIMAT0014606
• Description: Taeniopygia guttata tgu-miR-147 mature miRNA
• Sequence: 41 - GUGUGCGGAAAUGCUUCUGC - 60
• Evidence: experimental ; 454 [1], Illumina [1-2]

References

1. PubMed ID: 20360741
   The genome of a songbird
   "Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li"
   "Nature (2010) 464:757-762


2. PubMed ID: 23268654
   Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression
   Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X
   BMC Genomics (2012) 13:727