miRBase entry: eca-mir-433

Stem-loop eca-mir-433


Accession
MI0012902
Description
Equus caballus eca-mir-433 precursor miRNA
Gene family
MIPF0000177; mir-433

Literature search
2 open access papers mention eca-mir-433
(90 sentences)

Sequence

68 reads, 10 reads per million, 2 experiments
ugcccggggagaaguacggugagccugucauuauucagagaggcuagauccucuguguuaagaaggAUCAUGAUGGGCUCCUCGGUGUucuccagguagcggcaccacaccaugaaggcagccc
((((...((((((...(((.(((((((((((.(((((.(((((......))))).))........))).))))))))))).)))...)))))).))))..(((.((..........))..))).

Structure
--------------------------    cgg      gua   u           u   --------  g     cu 
                          ugcc   ggagaa   cgg gagccugucau auu        ca agagg  a
                          ||||   ||||||   ||| ||||||||||| |||        || |||||   
                          augg   ccucuU   GCU CUCGGGUAGUA UAg        gu ucucc  g
cccgacggaaguaccacaccacggcg    --a      GUG   C           C   gaagaauu  g     ua 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr24: 42745895-42746018 [+]
Clustered miRNAs
5 other miRNAs are < 10 kb from eca-mir-433
Name Accession Chromosome Start End Strand Confidence




Database links

Mature eca-miR-433

Accession MIMAT0013158
Description Equus caballus eca-miR-433 mature miRNA
Sequence 67 - AUCAUGAUGGGCUCCUCGGUGU - 88
Evidence not_experimental

References

  1. PubMed ID: 19406225
    In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach
    "Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y"
    "Genomics (2009) 94:125-131