miRBase entry: hsa-mir-548p

Stem-loop hsa-mir-548p


Accession
MI0006420
Symbol
HGNC: MIR548P
Description
Homo sapiens hsa-mir-548p precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR548P, a microRNA, plays a significant role in lipid metabolism by decreasing lipoprotein production and lipid synthesis in hepatocytes without affecting fatty acid oxidation [PMC7123062]. It achieves this by downregulating the activity of key enzymes such as 3-hydroxy 3-methylglutaryl-CoA reductase and long-chain acyl-CoA synthetase ACSL4, as well as by promoting the degradation of APOB mRNA, which reduces ApoB synthesis and secretion [PMC7123062]. In the context of esophageal squamous cell carcinoma (ESCC), MIR548P is associated with immune system modulation; its expression is inversely related to activated mast cells and positively related to activated CD4 memory T cells [PMC9509226]. However, high levels of MIR548P expression are linked to poor prognosis in ESCC, and this is associated with a decreased overall survival rate [PMC9509226]. The microRNA's expression is also associated with the immune microenvironment within tumors as analyzed by the CIBERSORT algorithm [PMC9509226]. No positive correlation has been established between MIR548P expression and clinicopathological features of ESCC patients [PMC9509226].

Literature search
42 open access papers mention hsa-mir-548p
(142 sentences)

Sequence

344 reads, 31 reads per million, 48 experiments
auuagguugguauaaaauuaauugcaguuuuugucauuacuuucaaUAGCAAAAACUGCAGUUACUUUugcaccaauguaauac
((((.((((((.(((((.((((((((((((((((.(((......))).)))))))))))))))).))))).)))))).))))..

Structure
--    g      a     u                c   ac 
  auua guuggu uaaaa uaauugcaguuuuugu auu  u
  |||| |||||| ||||| |||||||||||||||| |||   
  uaau uaacca guUUU AUUGACGUCAAAAACG Uaa  u
ca    g      c     C                A   cu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr5: 100816482-100816565 [-]

Disease association
hsa-mir-548p is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-548p

Accession MIMAT0005934
Description Homo sapiens hsa-miR-548p mature miRNA
Sequence 47 - UAGCAAAAACUGCAGUUACUUU - 68
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621