WARNING: This summary was generated by AI. Hsa-mir-1269 is a microRNA (miRNA) implicated in various cancers, including esophageal cancer (EC) and hepatocellular carcinoma (HCC) [PMC9200351; PMC7467934].'>PMC7467934].. It was identified among a set of differentially expressed miRNAs in EC, where higher expression levels were associated with shorter overall survival times [PMC9200351]. Additionally, hsa-mir-1269 is suggested to have a potential association with alcohol-related EC [PMC9200351]. In the context of serum biomarkers, hsa-mir-1269 was among the miRNAs assessed for levels using a specific PCR array technique [PMC5467072]. It also features in a miRNA signature comprising 23 miRNAs that have been identified for their roles in HCC [PMC7467934]. Furthermore, hsa-mir-1269 was listed as differentially expressed in an analysis using The Cancer Genome Atlas (TCGA) data set [PMC5950030], and it showed anti-correlated mRNA levels for certain genes within specific groupings, indicating its potential regulatory role in gene expression [PMC4175465]. The precursor expression vector for hsa-mir-1269 has been constructed to facilitate further research into its function and mechanisms of action within cancer biology [PMC6873743].
-- uugccua u a cuga ac ugga gaccagggaagccagu ggcauggcucagucca gu cc c |||| |||||||||||||||| |||||||||||||||| || || accu cuggucccuucGGUCA UCGUGCCGAGUCAGGU cg gg u cg ------- - C -uaa ag
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005923 |
| Description | Homo sapiens hsa-miR-1269a mature miRNA |
| Sequence | 67 - CUGGACUGAGCCGUGCUACUGG - 88 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|