Stem-loop hsa-mir-1248

Accession

MI0006383

Symbol

HGNC: MIR1248

Description

Homo sapiens hsa-mir-1248 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR1248 is a microRNA that exhibits a very high expression level in stallion sperm, with an expression count (AC) of 100 or greater, indicating its significant presence in these cells [PMC3569414]. It is known to target 154 genes and shows upregulation in certain human cell lines, such as SK-N-SH and K562 [PMC5600530]. Interestingly, MIR1248 may selectively target specific isoforms of OGG1 due to variations in the mRNA 3′UTR regions [PMC9118907]. In the context of drug resistance, MIR1248 is slightly up-regulated with moderate absolute expression levels in TamR cells [PMC3402532]. It has also been implicated in the regulation of genes associated with aging, as its regulation has been confirmed in old hematopoietic stem cells (HSC) compared to young HSC [PMC8296523]. Furthermore, MIR1248's expression levels are inversely correlated with PSMD10 expression levels [PMC9414407], and it is one of the top microRNAs that are upregulated following IFN-γ stimulation [PMC8010072]. This microRNA also shows differential regulation under conditions such as inflammation and drug resistance.

Literature search

16 open access papers mention hsa-mir-1248
(61 sentences)

Sequence

1022 reads, 198 reads per million, 115 experiments

uuuACCUUCUUGUAUAAGCACUGUGCUAAAauugcagacacuaggaccaugucuugguuuuugcaauaaugcuagcagaguacacacaagaagaaaaguaacagca
.....((((((((....(.(((.(((((..((((((((.((((((((...)))))))).)))))))).....))))).))).)..)))))))).............

Structure

--------uuuAC        AUAA C   G     ---AA        c        c 
             CUUCUUGU    G ACU UGCUA     auugcaga acuaggac  
             ||||||||    | ||| |||||     |||||||| |||||||| a
             gaagaaca    c uga acgau     uaacguuu ugguucug  
acgacaaugaaaa        --ca a   g     cguaa        u        u 

Annotation confidence Not enough data

Genome context

chr3: 186786672-186786777 [+]

Disease association

hsa-mir-1248 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-1248

• Accession: MIMAT0005900
• Description: Homo sapiens hsa-miR-1248 mature miRNA
• Sequence: 4 - ACCUUCUUGUAUAAGCACUGUGCUAAA - 30
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 18285502
   Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
   "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
   "Genome Res (2008) 18:610-621