MIR1244-1 is a microRNA (miRNA) that is less than 22 nucleotides in length and has been identified as a downregulated tumor suppressor in a cluster that includes six other tumor suppressors [PMC8465636]. This miRNA has been consistently observed across different tissue types, indicating its disease-specific differential expression [PMC8323253]. Furthermore, MIR1244-1 is among the miRNAs that undergo hypermethylation due to tobacco exposure in the foetal cord blood of low-birth-weight newborns of smoking mothers, which may influence foetoplacental angiogenic and growth factors [PMC9571148]. The hypermethylation of MIR1244-1 and other miRNAs has been associated with the disruption of protein expression and key factors necessary for proper placental development [PMC9571148]. Additionally, MIR1244-1 was one of seven hypermethylated miRNAs identified in a genetic study focusing on cord blood from low-birth-weight newborns with smoking mothers [PMC9571148]. In terms of its prognostic value, MIR1244-1 has been recognized as an independent prognostic factor for certain diseases through multivariate Cox regression analysis [PMC9691390].
--------- uccga uu ua uuuuug u uu aucuuau gca ccag acu ugua guac a ||||||| ||| |||| ||| |||| |||| UAGAGUA UGU GGUU UGA Auau caug g aaaaaUUGG ----- UU GA ------ - uc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005896 |
Description | Homo sapiens hsa-miR-1244 mature miRNA |
Sequence | 55 - AAGUAGUUGGUUUGUAUGAGAUGGUU - 80 |
Evidence |
experimental
Illumina [1] |
|