miRBase entry: hsa-mir-1305

Stem-loop hsa-mir-1305


Accession
MI0006372
Symbol
HGNC: MIR1305
Description
Homo sapiens hsa-mir-1305 precursor miRNA mir-1305
Gene
family?
RF04109; mir-1305

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1305 is a microRNA implicated in various cellular processes and clinical outcomes, particularly in cancer biology. Overexpression of circCOG2, a circular RNA, and its rescue by MIR1305 mimics resulted in the modulation of epithelial-mesenchymal transition (EMT) markers and TGF-β2 signaling pathway components, indicating a regulatory role of MIR1305 in these processes [PMC8505430]. In ovarian cancer, patients with a shallow deletion of MIR1305 and concurrent upregulation of DIRAS3 mRNA exhibited longer overall survival [PMC9101105]. This correlation was further supported by bioinformatic analysis showing that high DIRAS3 expression along with MIR1305 downregulation is associated with better clinical outcomes [PMC9101105]. Additionally, the expression levels of MIR1305 were found to be inversely correlated with DIRAS3 mRNA levels [PMC9101105]. In the context of osteogenic differentiation in periodontal ligament stem cells (PDLSCs), MIR1305 has been reported to be among the microRNAs that regulate this process [PMC8503254]. Furthermore, differentiation was found to suppress certain microRNAs including MIR1305 [PMC4168020]'>PMC4168020], while exposure to all-trans retinoic acid (atRA) induced its expression along with other miRNAs [PMC4168020]. Despite these findings, no direct link has been reported between MIR1305 and reproductive implantation failure (RIF) or its association with upstream circRNA [PMC7924221], indicating potential areas for future research.

Literature search
7 open access papers mention hsa-mir-1305
(63 sentences)

Sequence

356 reads, 5 reads per million, 40 experiments
aagauccugcuguuucuaccauuaguuuugaauguuuauuguaaagauacUUUUCAACUCUAAUGGGAGAGAcagcaggauucucc
..(((((((((((((((.(((((((..(((((....((((.....))))...)))))..))))))).)))))))))))))))....

Structure
--aa               a       uu     uguu    g 
    gauccugcuguuucu ccauuag  uugaa    uauu u
    ||||||||||||||| |||||||  |||||    |||| a
    uuaggacgacAGAGA GGUAAUC  AACUU    auag a
ccuc               G       UC     -UUc    a 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr4: 182169293-182169378 [+]

Disease association
hsa-mir-1305 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1305

Accession MIMAT0005893
Description Homo sapiens hsa-miR-1305 mature miRNA
Sequence 51 - UUUUCAACUCUAAUGGGAGAGA - 72
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621