miRBase entry: hsa-mir-1299

Stem-loop hsa-mir-1299


Accession
MI0006359
Symbol
HGNC: MIR1299
Description
Homo sapiens hsa-mir-1299 precursor miRNA mir-1299
Gene
family?
RF04142; mir-1299

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1299 is a microRNA that has recently been identified as a novel noncoding RNA marker, not previously associated with any diseases, including cancer [PMC5354851]. This microRNA has been reported for the first time to be expressed in ameloblastoma tumors, and it is overexpressed in these tumors alongside other miRNAs [PMC5354851]. The overexpression of MIR1299 is also observed in both Autism Spectrum Disorder (ASD) and Non-Typical Development (Non-TD) subjects, indicating its potential role in the etiopathogenesis of these conditions [PMC6814108]. Furthermore, MIR1299 is among the top upregulated genes in Non-TD subjects [PMC6814108]. The significance of MIR1299's overexpression in ameloblastomas has led to suggestions that it could serve as a valuable tumor marker for this type of tumor [PMC7920560]. Additionally, MIR1299 was identified as one of the top genes from a genetic screen indicating its potential importance in biological processes or disease states [PMC9402397]. However, the statement regarding MIR1299's selection for further analysis based on suppressed expression levels from Next Generation Sequencing (NGS) data cannot be confirmed with the provided references and should be omitted from the summary.

Literature search
9 open access papers mention hsa-mir-1299
(19 sentences)

Sequence

3343 reads, 43 reads per million, 88 experiments
ccucauggcaguguucuggaauccuacgugagggacaaucauucagacccacguagcagugUUCUGGAAUUCUGUGUGAGGGA
(((((..((((.((((((((((.(((((((.((..............)))))))))....)))))))))).)))).)))))..

Structure
--     ug    u          ---c       a  gacaau 
  ccuca  gcag guucuggaau    cuacgug gg      c
  |||||  |||| ||||||||||    ||||||| ||       
  GGAGU  UGUC UAAGGUCUUg    gaugcac cc      a
AG     -G    U          ugac       -  agacuu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr9: 40929010-40929092 [-]

Disease association
hsa-mir-1299 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1299

Accession MIMAT0005887
Description Homo sapiens hsa-miR-1299 mature miRNA
Sequence 62 - UUCUGGAAUUCUGUGUGAGGGA - 83
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621